View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17559_low_12 (Length: 251)
Name: NF17559_low_12
Description: NF17559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17559_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 19 - 246
Target Start/End: Original strand, 27201272 - 27201499
Alignment:
| Q |
19 |
gaacttacatcataacctatttttcttctttattatgttggtttctatcttgttcatggcttctgctcaattatcttcagatttctatggaacaacatgc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
27201272 |
gaacttacatcataacctatttttcttctttattatgttggtttctatcttgttcatggcttctgctcaattatcttcagatttttatggaacaacatgc |
27201371 |
T |
 |
| Q |
119 |
cctaaagccctttctatcataaactctgcagtgtgtagtgctgtttcgaaagaacatcgcatgggtgcttcattgcttcgtcttcatttccatgattgct |
218 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27201372 |
cctaaagccctttctatcataaactctgcggtgtgcagtgctgtttctaaagaacatcgcatgggtgcttcattgcttcgtcttcatttccatgattgct |
27201471 |
T |
 |
| Q |
219 |
ttgtcaatgcacgttctttcttctctct |
246 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
27201472 |
ttgtcaatgcacgttctttcttctctct |
27201499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.000000000006; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 179 - 227
Target Start/End: Original strand, 52301198 - 52301246
Alignment:
| Q |
179 |
atgggtgcttcattgcttcgtcttcatttccatgattgctttgtcaatg |
227 |
Q |
| |
|
||||||||||| |||||||||||||| || ||||||||||||||||||| |
|
|
| T |
52301198 |
atgggtgcttctttgcttcgtcttcactttcatgattgctttgtcaatg |
52301246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 157 - 222
Target Start/End: Complemental strand, 10084420 - 10084355
Alignment:
| Q |
157 |
tgctgtttcgaaagaacatcgcatgggtgcttcattgcttcgtcttcatttccatgattgctttgt |
222 |
Q |
| |
|
|||||| |||| ||| | |||| | ||||| || ||||| |||||||||||||||||||||||||| |
|
|
| T |
10084420 |
tgctgtgtcgagagatcgtcgcttaggtgcatccttgctccgtcttcatttccatgattgctttgt |
10084355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 179 - 227
Target Start/End: Complemental strand, 17549506 - 17549458
Alignment:
| Q |
179 |
atgggtgcttcattgcttcgtcttcatttccatgattgctttgtcaatg |
227 |
Q |
| |
|
|||| |||||| |||||||||||||| || |||||||||||||| |||| |
|
|
| T |
17549506 |
atggctgcttctttgcttcgtcttcactttcatgattgctttgtaaatg |
17549458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 195 - 227
Target Start/End: Original strand, 23229807 - 23229839
Alignment:
| Q |
195 |
ttcgtcttcatttccatgattgctttgtcaatg |
227 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
23229807 |
ttcgtcttcattttcatgattgctttgtcaatg |
23229839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University