View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17559_low_9 (Length: 313)
Name: NF17559_low_9
Description: NF17559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17559_low_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 16 - 297
Target Start/End: Complemental strand, 24268782 - 24268504
Alignment:
| Q |
16 |
gatggatctgtttcaaacttgcgacctaacatgatggagtggattgccatgttttatattttatttttactgtctttgtgtgccgcataatcatcaaccc |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24268782 |
gatggatctgtttcaaacttgcgacctaacatg---gagtggattgccatgttttatattttatttttactgtctttgtgtgccgcataatcatcaaccc |
24268686 |
T |
 |
| Q |
116 |
tttgctttcgggatattctgtcttgtttgttgtgttcatcttcaggtggtttggctttctttaacaacgacttcatccctaaacctttcgatcaatttaa |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24268685 |
tttgctttcgggatattctgtcttgtttgttgtgttcatcttcaggtggtttggctttctttaacaacgacttcatccctaaacctttcgatcaatttaa |
24268586 |
T |
 |
| Q |
216 |
acaataatggcaatgtatctttgttatatgtctaatgcattgctcttggtcatctaaaaacagctatcaacagaagcaagtg |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24268585 |
acaataatggcaatgtatctttgttatatgtctaatgcattgctcttggtcatctaaaaacagctatcaacagaagcaagtg |
24268504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University