View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1755_high_19 (Length: 267)
Name: NF1755_high_19
Description: NF1755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1755_high_19 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 166 - 251
Target Start/End: Original strand, 38899003 - 38899088
Alignment:
| Q |
166 |
agcaatttgattactcattcacccctccttacatgaaccagctgcatgagtgtaccttagaaaatttatcaccactcccagcagaa |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
38899003 |
agcaatttgattactcattcacccctccttacatgaaccagctgcatgagtgtagcttagaaaatttatcaccactccaagcagaa |
38899088 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 166 - 251
Target Start/End: Complemental strand, 38645495 - 38645416
Alignment:
| Q |
166 |
agcaatttgattactcattcacccctccttacatgaaccagctgcatgagtgtaccttagaaaatttatcaccactcccagcagaa |
251 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38645495 |
agcaatttgattactcattcac------ttacatgaaccagctgcatgagtgtaccttagaaaatttatcaccactcccagcagaa |
38645416 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 64; Significance: 5e-28; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 58 - 169
Target Start/End: Complemental strand, 15608391 - 15608280
Alignment:
| Q |
58 |
ataaataagttcaatcttaattttgacggtacaaaaaggtttaaaacaaaacatggcaacacatcattcgatacatgtttaaaataattttacactgacc |
157 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||| ||||||| ||||||||||||| |||||||||||||| |||| || |||||||| ||||||| | | |
|
|
| T |
15608391 |
ataaataagttcaatcttcattttgatggtacagaaaggttcaaaacaaaacatgacaacacatcattcggtacacgtgtaaaataactttacaccggca |
15608292 |
T |
|
| Q |
158 |
agatccaaagca |
169 |
Q |
| |
|
|||||||||||| |
|
|
| T |
15608291 |
agatccaaagca |
15608280 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 108 - 156
Target Start/End: Complemental strand, 2742183 - 2742135
Alignment:
| Q |
108 |
acatggcaacacatcattcgatacatgtttaaaataattttacactgac |
156 |
Q |
| |
|
|||||||||||||||||| ||| |||| |||||||||| ||||||||| |
|
|
| T |
2742183 |
acatggcaacacatcattggatgtatgtgtaaaataattgtacactgac |
2742135 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University