View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1755_low_13 (Length: 373)
Name: NF1755_low_13
Description: NF1755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1755_low_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 161; Significance: 9e-86; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 161; E-Value: 9e-86
Query Start/End: Original strand, 119 - 350
Target Start/End: Original strand, 16514890 - 16515120
Alignment:
| Q |
119 |
ttactagttatattatcaaaatacatggatggctggcttctatgatattttatgctgcttatcttgactttacaacaaaagttcttgagcagccatattt |
218 |
Q |
| |
|
||||||||| | ||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
16514890 |
ttactagttttcatatcaaactacatgggtggctggcttctatgatattttatgctgcttatcttgactttgcaacaaaagttcttgagcagccatattt |
16514989 |
T |
 |
| Q |
219 |
tatgcatttctcattatttttgtatttgatgtctttagttagtttgttggat--aaaaaatgcatttttccaacattgacgtccacgtttttcttaagca |
316 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||||||||||||||||||| |||||| ||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
16514990 |
tatgcacttctcatttattttgtatttgatgtctttagttagtttgttggataaaaaaaacgcatttttctaacattga---ccacgtttttcttaagca |
16515086 |
T |
 |
| Q |
317 |
atctcctgtatccttttaaggggtcacatgtcct |
350 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |
|
|
| T |
16515087 |
atctcctgtatccttttagggggtcacatgtcct |
16515120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 115 - 159
Target Start/End: Original strand, 16514846 - 16514890
Alignment:
| Q |
115 |
tattttactagttatattatcaaaatacatggatggctggcttct |
159 |
Q |
| |
|
||||||||||||| | |||||||| ||||||| |||||||||||| |
|
|
| T |
16514846 |
tattttactagttttcttatcaaactacatggctggctggcttct |
16514890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University