View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1755_low_18 (Length: 287)
Name: NF1755_low_18
Description: NF1755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1755_low_18 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 7 - 270
Target Start/End: Complemental strand, 3294241 - 3293978
Alignment:
| Q |
7 |
gtagcaaagggtaaatttaaggaagaacttgcaagaaagtacttccaacagcttataagtgctgtagattattgtcatagtagaggtgtttctcatcgtg |
106 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
3294241 |
gtagcaaaaggtaaatttaaggaagaacttgcaagaaagtacttccaacagcttataagtgctgtagattattgccatagtagaggtgtttctcatcgtg |
3294142 |
T |
 |
| Q |
107 |
atttaaaaccggagaatttattactcgatgaaaacgagaatcttaaagtctccgattttggtctctctgctttgcctgaacaacttcgtcaggacggact |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
3294141 |
atttaaaaccggagaatttattactcgatgaaaacgagaatcttaaagtctccgattttggtctctctgctttgcctgaacaccttcgtcaggacggact |
3294042 |
T |
 |
| Q |
207 |
tttacatactcaatgtggaactcctgcttacgtggcacccgaggtagttagaaaaagaggttat |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
3294041 |
tttacatactcaatgtggaactcctgcttatgtggcacccgaggtagttagaaaaagaggttat |
3293978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.000000000007; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 64 - 116
Target Start/End: Complemental strand, 9995146 - 9995094
Alignment:
| Q |
64 |
agtgctgtagattattgtcatagtagaggtgtttctcatcgtgatttaaaacc |
116 |
Q |
| |
|
|||||||| ||||| ||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
9995146 |
agtgctgttgattactgtcatagtagaggtgtttgtcatcgtgatttgaaacc |
9995094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 7 - 190
Target Start/End: Complemental strand, 881078 - 880895
Alignment:
| Q |
7 |
gtagcaaagggtaaatttaaggaagaacttgcaagaaagtacttccaacagcttataagtgctgtagattattgtcatagtagaggtgtttctcatcgtg |
106 |
Q |
| |
|
|||||||| || ||||| || ||||| |||| ||||||||||| ||||| || || |||||||| |||| ||| |||||| | ||||| | ||||| | |
|
|
| T |
881078 |
gtagcaaaaggaaaattgaatgaagatgttgctagaaagtactttcaacaactcattagtgctgttgatttttgccatagtcgtggtgtcacacatcgcg |
880979 |
T |
 |
| Q |
107 |
atttaaaaccggagaatttattactcgatgaaaacgagaatcttaaagtctccgattttggtctctctgctttgcctgaacaac |
190 |
Q |
| |
|
|||| ||||| || ||| || | | ||||||||||| | || || |||||||||||||| ||||| || ||||| ||||||| |
|
|
| T |
880978 |
atttgaaaccagaaaatctactcttggatgaaaacgaagacctcaaggtctccgattttggactctcagcgttgccagaacaac |
880895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 37 - 97
Target Start/End: Complemental strand, 22370112 - 22370052
Alignment:
| Q |
37 |
gcaagaaagtacttccaacagcttataagtgctgtagattattgtcatagtagaggtgttt |
97 |
Q |
| |
|
|||||||| || || || ||||||||| ||||||| ||||| ||||| ||||||||||||| |
|
|
| T |
22370112 |
gcaagaaaatattttcagcagcttatatgtgctgtggattactgtcacagtagaggtgttt |
22370052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University