View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1755_low_30 (Length: 204)
Name: NF1755_low_30
Description: NF1755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1755_low_30 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 121; Significance: 3e-62; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 121; E-Value: 3e-62
Query Start/End: Original strand, 23 - 186
Target Start/End: Complemental strand, 16471621 - 16471449
Alignment:
| Q |
23 |
aagtacaacgggatagaaaacttatggttgattgaga---------aaaactgaatgttgaacactttataagggagatgactcatatacctagtgtggt |
113 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
16471621 |
aagtacaacgggatagaaaacttctggttgattgagggggagatagaaaactgaatgttgaacactttataagggacatgactcatatacctagtgtggt |
16471522 |
T |
|
| Q |
114 |
gtcaacctctcgttcagctaactgtctttatcattttggcaacttaggattgttttatgattggtttgttccg |
186 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
16471521 |
gtcaacctctcattcagctaactgtctttatcattttggcaacttagaattgttttatgattggtttgttccg |
16471449 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 106 - 186
Target Start/End: Complemental strand, 16464504 - 16464427
Alignment:
| Q |
106 |
agtgtggtgtcaacctctcgttcagctaactgtctttatcattttggcaacttaggattgttttatgattggtttgttccg |
186 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||||||| |||| |||||||||||||| ||||| |
|
|
| T |
16464504 |
agtgtggtgtcaacctctcattcagctaactgtc--tatcattttggcaacttagaattg-tttatgattggtttattccg |
16464427 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University