View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17560_low_12 (Length: 237)
Name: NF17560_low_12
Description: NF17560
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17560_low_12 |
 | |
|
| [»] scaffold1064 (1 HSPs) |
| | |
|
Alignment Details
Target: chr8 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 20 - 214
Target Start/End: Complemental strand, 26825536 - 26825342
Alignment:
| Q |
20 |
agactggtaaagtggttaatggaacgatgttggggttcatgaaaataatttggaagatggatgtgataatctctaaaaatgatttgaagctatcagtatg |
119 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
26825536 |
agactggtaaggtggttaatggaacgatgttggggttcatgaaaataatttggaagatggatgtgataatctctaaaaatgatttgaagctatcagccag |
26825437 |
T |
|
| Q |
120 |
gactactgatctcttagatgattttccaccaatttcattagaagatcctcttgtagtaattgcagagtacattgctgcatactacaaggagactg |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26825436 |
gactactgatctcttagatgattttccaccaatttcattagaagatcctcttgtagtaattgcagagtacattgctgcatactacaaggagactg |
26825342 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1064 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold1064
Description:
Target: scaffold1064; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 171 - 206
Target Start/End: Complemental strand, 2685 - 2650
Alignment:
| Q |
171 |
tgtagtaattgcagagtacattgctgcatactacaa |
206 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |
|
|
| T |
2685 |
tgtagtaattgcagagtatattgctgcatactacaa |
2650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University