View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17561_high_2 (Length: 292)
Name: NF17561_high_2
Description: NF17561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17561_high_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 17 - 282
Target Start/End: Original strand, 188698 - 188968
Alignment:
| Q |
17 |
cgtgggtgactttacaccaaatttataaccagcatatcatacnnnnnnngacagaaccaacatatcatacttat-----aactgcacaaataaggtatta |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
188698 |
cgtgggtgactttacaccaaatttataaccagcatatcatactttttttgaccgaaccaacatatcatacttatattataactgcacaaataaggtatta |
188797 |
T |
 |
| Q |
112 |
ccctgacttaagagagatacatatgatatacatctaacctgaccataaatagaagaatattgttgcaaggaagttatatatgatggcatgatgccaaata |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
188798 |
ccctgacttaagagagatacatatgatatacatctaacctgaccataaatagaagaatattgttgcaaggaagttatatatgatggcatgatgccaaata |
188897 |
T |
 |
| Q |
212 |
ttttgagtggatatgacatttcattcattatgcgcgcacatccactttatgagttcgagagacaagaatta |
282 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
188898 |
ttttgagtggatatgacatttcattcattatgcgcgcgcatccactttatgagttcgagagacaagaatta |
188968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University