View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17561_low_5 (Length: 205)
Name: NF17561_low_5
Description: NF17561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17561_low_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 89; Significance: 4e-43; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 89; E-Value: 4e-43
Query Start/End: Original strand, 93 - 185
Target Start/End: Original strand, 43680849 - 43680941
Alignment:
| Q |
93 |
caaactcaaatcaccaaagttgaagagtaatttttcaaccaatttaaccctataaaaaccatctgcttaatgtctatctagagttacgtacaa |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43680849 |
caaactcaaatcaccaaagttgaagagtaatttttcaaccaatttaaccctagaaaaaccatctgcttaatgtctatctagagttacgtacaa |
43680941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 23 - 101
Target Start/End: Original strand, 43679832 - 43679910
Alignment:
| Q |
23 |
tgtgatcacatacgggacatgtttatagcttcagtgcctattttttcttttatgtttggtgtgttagtatcaaactcaa |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43679832 |
tgtgatcacatacgggacatgtttatagctttagtgcctattttttcttttatgtttggtgtgttagtatcaaactcaa |
43679910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University