View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17562_high_4 (Length: 317)
Name: NF17562_high_4
Description: NF17562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17562_high_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 14 - 300
Target Start/End: Original strand, 29061861 - 29062147
Alignment:
| Q |
14 |
gtgtgtggagataaagtcaaagaagagagggaaggctctgatagtacatagatgtctcataagtgaaaggatcttattgaccagtaacaaattcagacac |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29061861 |
gtgtgtggagataaagtcaaagaagagagggaaggctctgacattacatagatgtctcataagtgaaaggatcttattgaccagtaacaaattcagacat |
29061960 |
T |
 |
| Q |
114 |
tttaatttgtctttgtgtaggaaaaagttatcatgaattacacatatgcagacaatcttctttgctacgatttccagtaattttgtgatattagaaactt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29061961 |
tttaatttgtctttgtgtaggaaaaagttatcatgaattacacatatgcagacaatcttctttgctacgatttccagtaattttgtgatattagaaactt |
29062060 |
T |
 |
| Q |
214 |
tgaatttttaacacgttggttacttgattcatattttcttaagcctggaaatttttgaaagtgttgtttaagaagatattattttac |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29062061 |
tgaatttttaacacgttggttacttgattcatattttcttaagcctgtaaatttttgaaagtgttgtttaagaagatattattttac |
29062147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University