View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17563_low_16 (Length: 251)
Name: NF17563_low_16
Description: NF17563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17563_low_16 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 101; Significance: 4e-50; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 35805904 - 35806142
Alignment:
| Q |
1 |
atggtggtggtgtgattttgttgggttgcgattgttttgtggctaaagtannnnnnnnnnnnaataaaatggattatgacggagttttggttgtggtgtt |
100 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||||||||||||||||| ||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
35805904 |
atggtggtggtatgattttgttgggtgtcgattgttttgtggctaaagtattttttttttc-aatcaaatggactatgacggagttttggttgtggtgtt |
35806002 |
T |
|
| Q |
101 |
gatgatgaggagcttgtgggtgannnnnnnnnnnnnnnncttcccgttttttgctcatgatgacctcatatttgggtccatcacagccgctgcttactcg |
200 |
Q |
| |
|
|||||||||||| ||| |||||| ||||| ||||||||||||||||||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
35806003 |
gatgatgaggagtttgcgggtgatttttgttttttt---cttcctattttttgctcatgatgacctcatatttgggttcatctcagccgctgcttactcg |
35806099 |
T |
|
| Q |
201 |
cgtcggtttaaggttgtcttcgctttggctcgtggcttcattt |
243 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
35806100 |
cgtcggtttaaggttgtcttcgttttggctcgtggcttcattt |
35806142 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University