View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17563_low_17 (Length: 250)
Name: NF17563_low_17
Description: NF17563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17563_low_17 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 13 - 250
Target Start/End: Original strand, 29070899 - 29071136
Alignment:
| Q |
13 |
atactacggctgcacaatcgttatatcaaaaatatttcaagtattacgactgcaaaaccatcatatcaaaattcagacatatttgcatcgctctggattt |
112 |
Q |
| |
|
|||||||||||||||||| ||||||||| |||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29070899 |
atactacggctgcacaattgttatatcagaaatatttcaagtattacaactgcaaaaccattatatcaaaattcagacatatttgcatcgctctggattt |
29070998 |
T |
|
| Q |
113 |
tgatttacggttttgcagtcacaatcctaattaacaatctacttaatttctaattggctcttgcatttccatgtcaacatgatgttgcttgtgcacttca |
212 |
Q |
| |
|
|||| |||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29070999 |
tgatatacggttttgcagtcataacactaattaacaatctacttaatttctaattggctcttgcatttccatgtcaacatgatgttgcttgtgcacttca |
29071098 |
T |
|
| Q |
213 |
tctccaacacagtcagcatcatcagctccaatagcagc |
250 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
29071099 |
tctccaacacagtcagcatcatcaactccaatagcagc |
29071136 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University