View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17563_low_9 (Length: 350)
Name: NF17563_low_9
Description: NF17563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17563_low_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 322; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 322; E-Value: 0
Query Start/End: Original strand, 12 - 337
Target Start/End: Original strand, 49042259 - 49042584
Alignment:
| Q |
12 |
acagaccaaagaggaagagtagaaagattgaaccgatggctgtatcggtgtcaagttggacggtgtgttcgagtaagagttgtgagagacggtggagttt |
111 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49042259 |
acagaccaaaaaggaagagtagaaagattgaaccgatggctgtatcggtgtcaagttggacggtgtgttcgagtaagagttgtgagagacggtggagttt |
49042358 |
T |
 |
| Q |
112 |
tagatcggtgagttggaactgaacggtgaggaagagtaagagagggacgacgaatgtgaaaatgagaatggttgtggcattgcatgaatagccataacct |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49042359 |
tagatcggtgagttggaactgaacggtgaggaagagtaagagagggacgacgaatgtgaaaatgagaatggttgtggcattgcatgaatagccataacct |
49042458 |
T |
 |
| Q |
212 |
aactttacgtacttgagtttcaccgtttgtagaaaatccggtaaacgtcgccggattttgataacggcggaggttgaatctttgaaatccatctccgccg |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49042459 |
aactttacgtacttgagtttcaccgtttgtagaaaatccggtaaacgtcgccggattttgataacggcggaggttgaatctttgaaatccatctccgccg |
49042558 |
T |
 |
| Q |
312 |
ttagtctttctttatccatgtctatg |
337 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
49042559 |
ttagtctttctttatccatgtctatg |
49042584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University