View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17564_high_1 (Length: 459)
Name: NF17564_high_1
Description: NF17564
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17564_high_1 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 13 - 283
Target Start/End: Original strand, 9190710 - 9190976
Alignment:
| Q |
13 |
agcagagaaagccatcgtcaacaaaaattgaagcannnnnnnctttggaattctgcaataaccaacacaaagatgttaattaatcacataaaaagataca |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
9190710 |
agcagagaaagccatcgtcaacaaaaattgaagcatttttttctttggaattctgcaaaaaccaacacaaagatgttaattaatcacataaaaagagaca |
9190809 |
T |
 |
| Q |
113 |
aggttaacaactttaatatcaaatagatagataaagggtatttggattttgtgccnnnnnnncttggatgggtaaggttcaaagaaaatatttaactcaa |
212 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9190810 |
aggttaacaactttaatatcaaatagata----aagggtatttggattttgtgcctttttttcttggatgggtaaggttcaaagaaaatatttaactcaa |
9190905 |
T |
 |
| Q |
213 |
tgtttaagaagaagaaggtagatggtgtttgacaaggttagagagatagtgagatatcctggaaaattcaa |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
9190906 |
tgtttaagaagaagaaggtagatggtgtttgacaaggttagagagatagtgagatatcctggaaagttcaa |
9190976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University