View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17564_low_10 (Length: 257)
Name: NF17564_low_10
Description: NF17564
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17564_low_10 |
 | |
|
| [»] scaffold0010 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0010 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: scaffold0010
Description:
Target: scaffold0010; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 11 - 239
Target Start/End: Original strand, 27719 - 27947
Alignment:
| Q |
11 |
gaacctgtgtttcacaaagattgtttggatacatggattagatacaaatacaataatacaacttgccctctttgcagagtttcagtaggttcaataagag |
110 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27719 |
gaacatgtgtttcacaaagattgtttcgatacatggattagatacaaatacaataatacaacttgccctctttgcagagtttcagtaggttcaataagag |
27818 |
T |
|
| Q |
111 |
aggttgatgctcaagttatagtacatgatcattttcatgaattaccgtggctaaggtgacccttgacaattattgtcggtgctcgatcgttccaatagta |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27819 |
aggttgatgctcaagttatagtacatgatcattttcatgaattaccgtggctaaggtgacccttgacaattattgtcggtgctcgatcgttccaatagta |
27918 |
T |
|
| Q |
211 |
aatcaaatgatcggggttcgaactccggt |
239 |
Q |
| |
|
||| |||| |||||||||||||| ||||| |
|
|
| T |
27919 |
aataaaataatcggggttcgaaccccggt |
27947 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 23 - 128
Target Start/End: Original strand, 29691118 - 29691223
Alignment:
| Q |
23 |
cacaaagattgtttggatacatggattagatacaaatacaataatacaacttgccctctttgcagagtttcagtaggttcaataagagaggttgatgctc |
122 |
Q |
| |
|
|||||||||||||||||||| ||| ||| | |||||||| ||||||||||| |||||||||||||||||||| ||| || ||||||| |||||||| |
|
|
| T |
29691118 |
cacaaagattgtttggatacttggtatagctttaaatacaacaatacaacttgtcctctttgcagagtttcagttggtccactaagagaccttgatgcta |
29691217 |
T |
|
| Q |
123 |
aagtta |
128 |
Q |
| |
|
|||||| |
|
|
| T |
29691218 |
aagtta |
29691223 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University