View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17565_high_21 (Length: 250)
Name: NF17565_high_21
Description: NF17565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17565_high_21 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 17 - 250
Target Start/End: Complemental strand, 30699451 - 30699218
Alignment:
| Q |
17 |
gaataaggaggagcattgtgtttgatttgagagaccaatgcagccttggtaacacatatctagcacctttagtcggtatatggcagctaatacaaaagag |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
30699451 |
gaataaggaggagcattgtgtttgatttgagagaccaatgcagccttggtaacacatatctagcgcctttagtcggtatatggcagctaatacaaaagag |
30699352 |
T |
|
| Q |
117 |
agggttgaagctaggagagcgaagcaacgaattatggttggttgactcggtcgtgaaaagtgaagatttgtcatacttattgtaaggcaaatgtgtgtgc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30699351 |
agggttgaagctaggagagcgaagcaacgaattatggttggttgactcggtcgtgaaaagtgaagatttgtcatacttattgtaaggcaaatgtgtgtgc |
30699252 |
T |
|
| Q |
217 |
agatgccttgacaacctcactcgtattagttcct |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
30699251 |
agatgccttgacaacctcactcgtattagttcct |
30699218 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University