View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17565_high_28 (Length: 213)

Name: NF17565_high_28
Description: NF17565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17565_high_28
NF17565_high_28
[»] chr7 (1 HSPs)
chr7 (1-198)||(47107383-47107580)


Alignment Details
Target: chr7 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 1 - 198
Target Start/End: Original strand, 47107383 - 47107580
Alignment:
1 gggatgtgatattgttaatttcgttaggcatataactactcatcagtttcacataaccgtttcacatactcatcaatttgaaataggttataaataagtt 100  Q
    ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
47107383 gggatgtgatattgttaatttcgttaggcatataaatactcatcagtttcacataaccgtttcacatactcatcaatttgaaataggttataaataagtc 47107482  T
101 agtttaaaattcgtaaggatttaaacttcgatagataatggaggatggcttgtatattattaagatgtcctcattcgttcgtctcataaaatggaaac 198  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||| ||||||    
47107483 agtttaaaattcgtaaggatttaaacttcgatagataatggaggatggcttgtatattattaagatgtcctcgttcgttcttctcataaaacggaaac 47107580  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University