View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17565_high_9 (Length: 405)
Name: NF17565_high_9
Description: NF17565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17565_high_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 233; Significance: 1e-128; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 233; E-Value: 1e-128
Query Start/End: Original strand, 13 - 257
Target Start/End: Original strand, 45794862 - 45795106
Alignment:
| Q |
13 |
tgatgatgtctacactaccatgaatttcgcagtctctgtagaattggcgctgcgcgactgcgtataagcttccttctccgccgtcaattttgcagttgaa |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
45794862 |
tgatgatgtctacactaccatgaatttcgcagtctctgtagaattggcgctgcgcgactgcgtataagcttccttctccgccgtcaattttgcagctgaa |
45794961 |
T |
|
| Q |
113 |
gaatgctgcatgatcagaaagtacaaggagtgctgatgctcctggtacgctagctggagctgtgaaacccatatctttgcagatgaatcttttgcccttt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45794962 |
gaatgctgcatgatcagaaagtacaaggagtgctgatgctcctggtacgctagctggagctgtgaaacccatatctttgcagatgaatcttttgcccttt |
45795061 |
T |
|
| Q |
213 |
accactgcatttcacaagagtcaaaatcaaatgttgttatgtgtg |
257 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
45795062 |
accactgcatttcacaagagtgaaaatcaaatgttgttatatgtg |
45795106 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 101; E-Value: 6e-50
Query Start/End: Original strand, 291 - 395
Target Start/End: Original strand, 45795098 - 45795202
Alignment:
| Q |
291 |
ttatatgtgttgtttttagtactcggtagatattaatgtttttattttagtccctgtaaaactaattcttattattgataaagatgattatcttctttag |
390 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
45795098 |
ttatatgtgttgtttttagtactcggtagatattaatgtttttattttagtccctgtaaaactaattcttattattaataaagatgattatcttctttag |
45795197 |
T |
|
| Q |
391 |
tctct |
395 |
Q |
| |
|
||||| |
|
|
| T |
45795198 |
tctct |
45795202 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University