View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17565_low_14 (Length: 344)
Name: NF17565_low_14
Description: NF17565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17565_low_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 316; Significance: 1e-178; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 316; E-Value: 1e-178
Query Start/End: Original strand, 14 - 337
Target Start/End: Original strand, 45794548 - 45794871
Alignment:
| Q |
14 |
atcaattccatagttatcactaaatttacaccaaccttttggacgtacaacatcaccaagaaatgattccattatgattgttcttgaatattggtcacgc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45794548 |
atcaattccatagttatcactaaatttacaccaaccttttggacgtacaacatcaccaagaaatgattccattatgattgttcttgaatattggtcacgc |
45794647 |
T |
 |
| Q |
114 |
ggagttcccaaacatgtcgaaccaacaagacttttatcactgattttgccttgttctgctatgatggtgcagttttggatcacaagtccagttttctcat |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45794648 |
ggagttcccaaacatgtcgaaccaacaagacttttatcattgattttgccttgttctgctatgatggtgcagttttggatcacaagtccagttttctcat |
45794747 |
T |
 |
| Q |
214 |
atttgtctagtcttgattgaacactcaccacattttttctcagagctaagctagaagaatttcgatgcttcacaattatttgcgagttttgaattatagt |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
45794748 |
atttgtctagtcttgattgaacactcaccacattttttctcagagctaagctagaagaatttcggtgcttcacaattatttgcgagttttgaattatagt |
45794847 |
T |
 |
| Q |
314 |
tgctgagtctcctttgatgatgtc |
337 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
45794848 |
tgctgagtctcctttgatgatgtc |
45794871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University