View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17565_low_29 (Length: 213)
Name: NF17565_low_29
Description: NF17565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17565_low_29 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 1 - 198
Target Start/End: Original strand, 47107383 - 47107580
Alignment:
| Q |
1 |
gggatgtgatattgttaatttcgttaggcatataactactcatcagtttcacataaccgtttcacatactcatcaatttgaaataggttataaataagtt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47107383 |
gggatgtgatattgttaatttcgttaggcatataaatactcatcagtttcacataaccgtttcacatactcatcaatttgaaataggttataaataagtc |
47107482 |
T |
|
| Q |
101 |
agtttaaaattcgtaaggatttaaacttcgatagataatggaggatggcttgtatattattaagatgtcctcattcgttcgtctcataaaatggaaac |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||| |||||| |
|
|
| T |
47107483 |
agtttaaaattcgtaaggatttaaacttcgatagataatggaggatggcttgtatattattaagatgtcctcgttcgttcttctcataaaacggaaac |
47107580 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University