View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17565_low_9 (Length: 413)
Name: NF17565_low_9
Description: NF17565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17565_low_9 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 116; Significance: 7e-59; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 116; E-Value: 7e-59
Query Start/End: Original strand, 10 - 137
Target Start/End: Complemental strand, 5997986 - 5997859
Alignment:
| Q |
10 |
ataatactaaggggggccataaacaaggaaagaattttcttcagtgagtccaatgtgcctcttcagttctggaacaccgtaacactaagggcaaccatcg |
109 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5997986 |
ataacactaaggggggccataaacaaggaaagaattttcttcagtgagtccaatgtgccccttcagttctggaacaccgtaacactaagggcaaccatcg |
5997887 |
T |
|
| Q |
110 |
acaagaaaagacagagaataccaaattt |
137 |
Q |
| |
|
|| ||||||||||||||||||||||||| |
|
|
| T |
5997886 |
acgagaaaagacagagaataccaaattt |
5997859 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University