View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17567_high_9 (Length: 355)

Name: NF17567_high_9
Description: NF17567
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17567_high_9
NF17567_high_9
[»] chr4 (1 HSPs)
chr4 (30-342)||(42445377-42445689)


Alignment Details
Target: chr4 (Bit Score: 313; Significance: 1e-176; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 313; E-Value: 1e-176
Query Start/End: Original strand, 30 - 342
Target Start/End: Original strand, 42445377 - 42445689
Alignment:
30 caagcactattgacagaaccattgtggcaacagcagtgcttggaaatggggaagaatttgagggcgaatctgttttccagccttccgatttctctccaac 129  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42445377 caagcactattgacagaaccattgtggcaacagcagtgcttggaaatggggaagaatttgagggcgaatctgttttccagccttccgatttctctccaac 42445476  T
130 actgttgcccttagcatatgcaggaataaatggcaaagtagaatcttcattttgtgctaatggatccttgagtgacattgacttcagaggaaaggttgtt 229  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42445477 actgttgcccttagcatatgcaggaataaatggcaaagtagaatcttcattttgtgctaatggatccttgagtgacattgacttcagaggaaaggttgtt 42445576  T
230 ttgtgtgagaggggagggggtataggaagaattgccaaaggacaggaagtacaaagagcaggtggtgccgccatgattctcatgaatgatgaactcaatg 329  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42445577 ttgtgtgagaggggagggggtataggaagaattgccaaaggacaggaagtacaaagagcaggtggtgccgccatgattctcatgaatgatgaactcaatg 42445676  T
330 gtttcagtctctc 342  Q
    |||||||||||||    
42445677 gtttcagtctctc 42445689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University