View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17568_high_7 (Length: 272)
Name: NF17568_high_7
Description: NF17568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17568_high_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 24 - 221
Target Start/End: Original strand, 9630349 - 9630546
Alignment:
| Q |
24 |
tgggtagattattctaggacttggtggtaaaggtcttggacttggtacttcattgtaaacttttctttgtttcttggattctaggcattgtagtagttga |
123 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9630349 |
tgggaagattattctaggacttggtggtaaaggtcttggacttggtacttcattgtaaacttttctttgtttcttggattctaggcattgtagtagttga |
9630448 |
T |
 |
| Q |
124 |
tgtaactcgttgatgtaatcaattacactttcaactattgatgcttgatctccctaaaccatataggagagtaattagttgcatttttcatacaaaaa |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9630449 |
tgtaactcgttgatgtaatcaattacactttcaactattgatgcttgatctccctaaaccatataggagagtaattagttgcatttttcatacaaaaa |
9630546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 59; Significance: 5e-25; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 57 - 179
Target Start/End: Complemental strand, 41257695 - 41257573
Alignment:
| Q |
57 |
tcttggacttggtacttcattgtaaacttttctttgtttcttggattctaggcattgtagtagttgatgtaactcgttgatgtaatcaattacactttca |
156 |
Q |
| |
|
|||||||||| |||||||| |||| ||||||||||||||||||| ||| ||| ||| |||||||| || ||||| |||||||||||| ||||| | || |
|
|
| T |
41257695 |
tcttggacttagtacttcactgtatacttttctttgtttcttggcttcaagggcttggagtagttgttgcaactctgtgatgtaatcaactacacctcca |
41257596 |
T |
 |
| Q |
157 |
actattgatgcttgatctcccta |
179 |
Q |
| |
|
| ||||||||||||||||||||| |
|
|
| T |
41257595 |
attattgatgcttgatctcccta |
41257573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University