View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17569_high_19 (Length: 349)
Name: NF17569_high_19
Description: NF17569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17569_high_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 34 - 333
Target Start/End: Complemental strand, 31033515 - 31033216
Alignment:
| Q |
34 |
atgtcacatagaaatggacgtcttttcaggtacatgggtggagtggttatgtgttgaaagagaaatttaaactgataagggatgtctgaagagttggcat |
133 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31033515 |
atgtcacatagaaatggacgtcttttcaggtacatgggtggagtggttatgtgttgaaagagaaatttaaactgataagggatgtctgaagagttggcat |
31033416 |
T |
 |
| Q |
134 |
caaagccatacccaaaacatagaaggaagaattcggttggttaaagattgtatgtctttcttggatattaaannnnnnntgcaaatgattcaagcggagg |
233 |
Q |
| |
|
|||| ||||||||||||| ||||||| ||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||| | |
|
|
| T |
31033415 |
caaaaccatacccaaaacttagaaggtagaattcggttggttaaagatcgtatgtctttcttggatattaaaggggaggtgcaaatgattcaagcggatg |
31033316 |
T |
 |
| Q |
234 |
agatggaagagcttcattctttatcaacagatgaaacaactttattcaaattgcattcaggtattcagtcgcaaaaaacttagaatagattggttaaagg |
333 |
Q |
| |
|
||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31033315 |
agatggaagagtttcattctttatcagcagatgaaacaactttattcaaattgcattcaggtattcagtcgcaaaaaacttagaatagattggttaaagg |
31033216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University