View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17569_high_20 (Length: 349)
Name: NF17569_high_20
Description: NF17569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17569_high_20 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 327; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 327; E-Value: 0
Query Start/End: Original strand, 1 - 331
Target Start/End: Complemental strand, 34572088 - 34571758
Alignment:
| Q |
1 |
tacttgttagtgtatgcacccctgaggttccttatgggaattcatttcaggtcgaaattctttacaagataatgcctggcgaagatgtgtcttgtgtaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34572088 |
tacttgttagtgtatgcacccctgaggttccttatgggaattcatttcgggtcgaaattctttacaagataatgcctggcgaagatgtgtcttgtgtaaa |
34571989 |
T |
|
| Q |
101 |
ggaatcctcacatcttgtgataacgtggggaatggttttcctacaaagcacaatgatgaaaggtgtgatagagaatggggctaaacaaggtttgaaggag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34571988 |
ggaatcctcacatcttgtgataacgtggggaatggttttcctacaaagcacaatgatgaaaggtgtgatagagaatggggctaaacaaggtttgaaggag |
34571889 |
T |
|
| Q |
201 |
agttttgatcagtttgctaacctacttgctcagaggttcaaggtgctagataaggaggatttgataaacaaagaacatttgttggcaactttgcagacag |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34571888 |
agttttgatcagtttgctaacctacttgctcagaggttcaaggtgctagataaggaggatttgataaacaaagaacatttgttggcaactttgcagacag |
34571789 |
T |
|
| Q |
301 |
agagccagtggaattggtggcaggcaattac |
331 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
34571788 |
agagccagtggaattggtggcaggcaattac |
34571758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University