View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17569_high_34 (Length: 280)
Name: NF17569_high_34
Description: NF17569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17569_high_34 |
 |  |
|
| [»] scaffold0365 (1 HSPs) |
 |  |  |
|
| [»] scaffold0400 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0365 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: scaffold0365
Description:
Target: scaffold0365; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 18 - 274
Target Start/End: Original strand, 2582 - 2838
Alignment:
| Q |
18 |
attcgtacaggtgaagatgtgaagctttcgaggagggttgtcgcggtttttgttatgatgactatggctgatttttgtgatcagctttttggttttcaag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2582 |
attcgtacaggtgaagatgtgaagctttcgaggagggttgtcgcggtttttgttatgatgactatggctgatttttgtgatcagctttttggttttcaag |
2681 |
T |
 |
| Q |
118 |
atatgttgtttgagaactttgatggtaggcttgagtttaaagggaacaattttggtgctgtttggcccggaaatggtaagccgggtttgtggttgaattc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
2682 |
atatgttgtttgagaactttgatggtaggcttgagtttaaagggaacaattttggtgctgtttggccgggaaatggtaagccgggtttgtggttgaattc |
2781 |
T |
 |
| Q |
218 |
tatttcgaggatgggagctgtttacaatttgattctgagagaggaagagatattctt |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2782 |
tatttcgaggatgggagctgtttacaatttgattctgagagaggaagagatattctt |
2838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0400 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: scaffold0400
Description:
Target: scaffold0400; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 45 - 274
Target Start/End: Original strand, 1965 - 2194
Alignment:
| Q |
45 |
tcgaggagggttgtcgcggtttttgttatgatgactatggctgatttttgtgatcagctttttggttttcaagatatgttgtttgagaactttgatggta |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1965 |
tcgaggagggttgtcgcggtttttgttatgatgactatggctgatttttgtgatcagctttttggttttcaagatatgttgtttgagaactttgatggta |
2064 |
T |
 |
| Q |
145 |
ggcttgagtttaaagggaacaattttggtgctgtttggcccggaaatggtaagccgggtttgtggttgaattctatttcgaggatgggagctgtttacaa |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2065 |
ggcttgagtttaaagggaacaattttggtgctgtttggccgggaaatggtaagccgggtttgtggttgaattctatttcgaggatgggagctgtttacaa |
2164 |
T |
 |
| Q |
245 |
tttgattctgagagaggaagagatattctt |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
2165 |
tttgattctgagagaggaagagatattctt |
2194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University