View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17569_high_37 (Length: 273)
Name: NF17569_high_37
Description: NF17569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17569_high_37 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 83; Significance: 2e-39; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 98 - 196
Target Start/End: Complemental strand, 47691805 - 47691708
Alignment:
| Q |
98 |
cacacacagtctaacgtgcttctttaaatcttctttctatctaacgtgcttacgatagtaaatcacaaaattgcacgacgaaacatatcatggataatg |
196 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
47691805 |
cacacacagtctaacgtgcttctttaaatattctttctgtctaacgtgcttacgatagtaaatcacaaaattgcacgacg-aacatatcatggataatg |
47691708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 117 - 172
Target Start/End: Complemental strand, 47680112 - 47680057
Alignment:
| Q |
117 |
ttctttaaatcttctttctatctaacgtgcttacgatagtaaatcacaaaattgca |
172 |
Q |
| |
|
||||||| || ||| |||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
47680112 |
ttctttacattttcattctgtctaacgtgcttacgatagtaaattacaaaattgca |
47680057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 45 - 76
Target Start/End: Complemental strand, 47691844 - 47691813
Alignment:
| Q |
45 |
ttgttatctctcatcattagttctataaacac |
76 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
47691844 |
ttgttatctctcatcattagttctataaacac |
47691813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 48 - 82
Target Start/End: Original strand, 19973159 - 19973193
Alignment:
| Q |
48 |
ttatctctcatcattagttctataaacactttctc |
82 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |
|
|
| T |
19973159 |
ttatccctcatcattagttctataaacactttctc |
19973193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University