View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17569_high_40 (Length: 264)
Name: NF17569_high_40
Description: NF17569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17569_high_40 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 17 - 116
Target Start/End: Complemental strand, 31033976 - 31033877
Alignment:
| Q |
17 |
atactccggtgacttgaatgggtctcaatttatccgatattgaaacatggctaaatgaatgtcaaaataaataaattttctagttgtgtcaacgaagagc |
116 |
Q |
| |
|
|||||||| ||||||||||||||||| |||||||| || |||| ||| ||||||||||||||||||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
31033976 |
atactccgatgacttgaatgggtctccatttatccaattttgagacacggctaaatgaatgtcaaaataaataaattttctagttgtgttaacaaagagc |
31033877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University