View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17569_high_42 (Length: 254)
Name: NF17569_high_42
Description: NF17569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17569_high_42 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 17 - 246
Target Start/End: Complemental strand, 41347475 - 41347246
Alignment:
| Q |
17 |
caatatttttaggagtgattaattttaattagtggtgagacaatttaaaattaattataagagcgttaaaagtatcagatttataagagtgttaatggaa |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41347475 |
caatatttttaggagtgattaattttaattagtggtgagacaatttaaaattaattatatgagcgttaaaagtatcagatttataagagtgttaatggaa |
41347376 |
T |
 |
| Q |
117 |
attagaatattgtattgttagcgacgtgtgccttgaactgagattaaaccaagtcagatttattttcatattttgtccttccttcctattgaatctcacg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
41347375 |
attagaatattgtattgttagcgacgtgtgcctttaactgagattaaaccgagtcagatttattttcatattttgtccttccttcctattgaagctcacg |
41347276 |
T |
 |
| Q |
217 |
cccgagccctcactctctcgatttcatctc |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
41347275 |
cccgagccctcactctctcgatttcatctc |
41347246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University