View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17569_high_50 (Length: 238)
Name: NF17569_high_50
Description: NF17569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17569_high_50 |
 |  |
|
| [»] scaffold0140 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0140 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: scaffold0140
Description:
Target: scaffold0140; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 3 - 220
Target Start/End: Complemental strand, 32730 - 32512
Alignment:
| Q |
3 |
ccgttttttcatgttttaattcaatgaatttctctttgatatgaattaattcgagtttattccgtctatttcttcatttcatttcat-----aggaaaaa |
97 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
32730 |
ccgttttttcatgttttaatttaatgaatttctctttgatatgaatt----cgagtttattccgtctatttcttcatttcatttcatttcatatgaaaaa |
32635 |
T |
 |
| Q |
98 |
gacgtacggtcaagatatggcttgatgagtaatgtatatagacctaggtagttagtgtttggtgactaaccctaaccctaacatgtgtagatttatatta |
197 |
Q |
| |
|
||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32634 |
gacgtacggtcaatatatggcttgatgagtactgtatatagacctaggtagttagtgtttggtgactaaccctaaccctaacatgtgtagatttatatta |
32535 |
T |
 |
| Q |
198 |
aaagctagtaggggtaaggcact |
220 |
Q |
| |
|
||||||||||||||||| ||||| |
|
|
| T |
32534 |
aaagctagtaggggtaaagcact |
32512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University