View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17569_high_51 (Length: 237)
Name: NF17569_high_51
Description: NF17569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17569_high_51 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 147; Significance: 1e-77; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 20 - 221
Target Start/End: Complemental strand, 18751498 - 18751296
Alignment:
| Q |
20 |
aatttttcctgatttaggaattcactgagatcgtatctcatcccattatgttgannnnnnnnc-caggtataagttattttgaagtctgtcggataccga |
118 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
18751498 |
aatttttcttgatttaggaactcactgagatcgtatctcatcccattatgttgatttcttttttcaggtataagttattttgaagtctgtcggataccga |
18751399 |
T |
 |
| Q |
119 |
atcacaaatgtctaaagtctagaattctcaattatagtttaaacttccccctttttgtaaaatgtggctgattgtatttaacgttatatttcaatttatc |
218 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
18751398 |
atcacaaatgtctaaagtctagaactctcaattatagtttaaacttctccctttttgtaaaatgtggctgattgtatttgacgttatatttcaatttatc |
18751299 |
T |
 |
| Q |
219 |
tct |
221 |
Q |
| |
|
||| |
|
|
| T |
18751298 |
tct |
18751296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 110 - 209
Target Start/End: Complemental strand, 22313887 - 22313787
Alignment:
| Q |
110 |
ggataccgaatcacaaatgtctaaagtctagaattctcaattatagtttaaacttccccctttttgtaaaatgtggctga--ttgtatttaacgttatat |
207 |
Q |
| |
|
||||| || ||||||| ||| || |||||||| ||| || ||||||||| ||||| |||| |||||||||||||||||| |||||||||| ||| ||| |
|
|
| T |
22313887 |
ggatatcggatcacaagtgtttatagtctaga-ttcccagttatagttttaacttttccctctttgtaaaatgtggctgattttgtatttaaagttctat |
22313789 |
T |
 |
| Q |
208 |
tt |
209 |
Q |
| |
|
|| |
|
|
| T |
22313788 |
tt |
22313787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University