View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17569_low_33 (Length: 289)
Name: NF17569_low_33
Description: NF17569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17569_low_33 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 12 - 267
Target Start/End: Complemental strand, 103532 - 103265
Alignment:
| Q |
12 |
agagaatgttggaggaagacgaagacgcagtgttgttgtcatcgtcgtcttcttcttctgattccgatgaagaagttgaagtgtcatcgtcttcttcttc |
111 |
Q |
| |
|
||||||||||||||||||||||||||| ||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
103532 |
agagaatgttggaggaagacgaagacgtagttttgttgtcatcgtcgtctttttcttctgattccgatgaagaagttgaagtgtcatcgtcttcttcttc |
103433 |
T |
 |
| Q |
112 |
t------------gattccgaaattgaacaagtttcacaacggaaatctcagaatgtagaagccctaatcaaaggtaaccttattgtgaagagacagtcg |
199 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
103432 |
ttcttcttcttctgattccgaaattgaacaagtttcacaacggaaatctcagaatgtagaagccctaatcaaaggtaaccttattgtgaagagacagtcg |
103333 |
T |
 |
| Q |
200 |
ttgctgccgagagtatattccaccaatggagctgccgctatttgcagaaaaccgtttaaaccaccgtc |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
103332 |
ttgctgccgagagtatattccaccaatggagctgccgctatttgcagaaaaccgtttaaaccaccgtc |
103265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University