View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17569_low_39 (Length: 277)
Name: NF17569_low_39
Description: NF17569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17569_low_39 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 18 - 270
Target Start/End: Original strand, 34296065 - 34296317
Alignment:
| Q |
18 |
caatcttaatgaacttaaacatgtcttataccaatcaaaaaccaccatgctcctcactcttcacattcgcaaccataaaccatgttcaacttcttcaaaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
34296065 |
caatcttaatgaacttaaacatgtcttataccaatcaaaaaccaccatgctcctcactcttcacattcacaaccataaaccatgttcaacttcttcaaaa |
34296164 |
T |
 |
| Q |
118 |
gattatgccttctaatatttttcctcttgctatcctttgatgtttgtgtgtgtttatcttcttcacttgggaacttcaagttttgtttggataataacaa |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34296165 |
gattatgccttctaatatttttcctcttgctatcctttgatgtttctgtgtgtttatcttcttcacttgggaacttcaagttttgtttggataataacaa |
34296264 |
T |
 |
| Q |
218 |
aataaaaaactttactgttttcccttacaaagaacatgatcaatcctatgcta |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34296265 |
aataaaaaactttactgttttcccttacaaagaacatgatcaatcctatgcta |
34296317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University