View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17569_low_43 (Length: 269)
Name: NF17569_low_43
Description: NF17569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17569_low_43 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 18 - 269
Target Start/End: Complemental strand, 7212066 - 7211811
Alignment:
| Q |
18 |
gagcatattctcttgacatcatacctacttatgtcaaagttggtcacagcacttgttcccctaaacttgattgctgcaatatcatatgcttctgcagcct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7212066 |
gagcatattctcttgacatcatacctacttatgtcaaagttggtcacagcacttgttcccctaaacttgattgctgcaatatcatatgcttctgcagcct |
7211967 |
T |
|
| Q |
118 |
cttcttgcgtgcctatataatttttatggctcactaattagataaaatatcaagatactcaattaaactagaacatgatatcataaaagtcagattatat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7211966 |
cttcttgcgtgcctatataatttttatggctcactaattagataaaatatcaagatactcaattaaactagaacatgatatcataaaagtcagattatat |
7211867 |
T |
|
| Q |
218 |
ttcacac----tatcatgcttaacaacaatgcaaaatagaatgaatgcgtaggttt |
269 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7211866 |
ttcacactatatatcatgcttaacaacaatgcaaaatagaatgaatgcgtaggttt |
7211811 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 78 - 132
Target Start/End: Original strand, 53233865 - 53233919
Alignment:
| Q |
78 |
ctaaacttgattgctgcaatatcatatgcttctgcagcctcttcttgcgtgccta |
132 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||||||| |||||||| ||||||| |
|
|
| T |
53233865 |
ctaaatttgattgctgcaatatcatacgcttctgcagcttcttcttgagtgccta |
53233919 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 30 - 132
Target Start/End: Original strand, 30618291 - 30618393
Alignment:
| Q |
30 |
ttgacatcatacctacttatgtcaaagttggtcacagcacttgttcccctaaacttgattgctgcaatatcatatgcttctgcagcctcttcttgcgtgc |
129 |
Q |
| |
|
||||||||||| || || ||||||||||| || || ||||| ||| || || || |||||||| | ||||||||| ||||| ||||||||||| |||| |
|
|
| T |
30618291 |
ttgacatcatatctgctcatgtcaaagtttgtaactgcactcagtcctctgaattttattgctgccacatcatatgcctctgctgcctcttcttgagtgc |
30618390 |
T |
|
| Q |
130 |
cta |
132 |
Q |
| |
|
||| |
|
|
| T |
30618391 |
cta |
30618393 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University