View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17569_low_61 (Length: 204)
Name: NF17569_low_61
Description: NF17569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17569_low_61 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 146; Significance: 4e-77; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 19 - 189
Target Start/End: Original strand, 664854 - 665024
Alignment:
| Q |
19 |
acagattacaggatgtatgtatttgaaagagtatnnnnnnntagtttatgatgtgttaccactgcacaagaattaatgcacacacagtgaatgaaaaatg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
664854 |
acagattacaggatgtatgtatttgaaagagtataaaaaaatagtttatgatgtgttaccactgcacaagaattaatacacacacagtgaatgaaaaatg |
664953 |
T |
|
| Q |
119 |
acagaatcaaagacgtatattagaatgtacaattttgaaggggtaaattttaagctattttgtcttctgtg |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
664954 |
acagaatcaaagacgtatattagaatgtacaattttgaaggggtaaattttaagctattttgtcttctgtg |
665024 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University