View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1756_low_19 (Length: 300)
Name: NF1756_low_19
Description: NF1756
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1756_low_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 105; Significance: 2e-52; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 176 - 288
Target Start/End: Original strand, 53940184 - 53940296
Alignment:
| Q |
176 |
tgtcatcaaggttgtctcaattggttgttaaaatatcactaatcttttgttaattatctttaaacaagttgacgagagtatctaaagccaaattctcaca |
275 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53940184 |
tgtcatcaaggttgtctcaattagttgttaaaatatcactaatcttttgtaaattatctttaaacaagttgacgagagtatctaaagccaaattctcaca |
53940283 |
T |
|
| Q |
276 |
ttcattcttctct |
288 |
Q |
| |
|
||||||||||||| |
|
|
| T |
53940284 |
ttcattcttctct |
53940296 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 19 - 100
Target Start/End: Original strand, 53940027 - 53940108
Alignment:
| Q |
19 |
aataccccaatacaaccatggtaactaaaattataattttgtaaagggaaaaaattatatttatacaaccactttatgataa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
53940027 |
aataccccaatacaaccatggtaactaaaattataattttgtaaagagaaaaaattatatttatacaaccactttatgataa |
53940108 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 186 - 226
Target Start/End: Complemental strand, 39241224 - 39241184
Alignment:
| Q |
186 |
gttgtctcaattggttgttaaaatatcactaatcttttgtt |
226 |
Q |
| |
|
|||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
39241224 |
gttgtctcaaatggttgttaaaatatcactactcttttgtt |
39241184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 67 - 100
Target Start/End: Complemental strand, 32510904 - 32510871
Alignment:
| Q |
67 |
aaaaaattatatttatacaaccactttatgataa |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |
|
|
| T |
32510904 |
aaaaaattatatttatacaaccaatttatgataa |
32510871 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University