View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1756_low_23 (Length: 253)
Name: NF1756_low_23
Description: NF1756
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1756_low_23 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 109; Significance: 6e-55; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 55 - 239
Target Start/End: Complemental strand, 7749143 - 7748954
Alignment:
| Q |
55 |
catattacatcataacatgatacattaa---ttaaggttttgtttttgg--tatattgataggttagattgatnnnnnnnntacatttgttttgtgaatg |
149 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| ||||||||| || ||||| |||||||| |||||| ||||| ||||||||||||| |
|
|
| T |
7749143 |
catattacatcataacatgatacattaaacattaagattttgttttgggagtatatggataggttgaattgatcgaaaaaatacatatgttttgtgaatg |
7749044 |
T |
 |
| Q |
150 |
ttcacattgaaaacactatgaaacctattcatttcagaacatcaacacaaatcatgcacttggacaatcagtctcatttggaaggttcat |
239 |
Q |
| |
|
||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7749043 |
ttcacattgaaaaaactatgaaacttattcatttcagaacatcaacacaaatcatgcacttggacaatcagtctcatttggaaggttcat |
7748954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University