View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1756_low_24 (Length: 251)
Name: NF1756_low_24
Description: NF1756
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1756_low_24 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 88 - 251
Target Start/End: Complemental strand, 6817292 - 6817129
Alignment:
| Q |
88 |
tgaaccaagccgcactgagaaaaccgaactgtaattgacagttcacgaacttaaccagtttggtgcagttcaatttgtgaactatctatcacagtttggt |
187 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
6817292 |
tgaaccaagccgcactgagaaaaccaaactgtaattgacagttcacgaacttaaccagtttggtgcagttcaattcgtgaactatctgtcacagtttggt |
6817193 |
T |
 |
| Q |
188 |
tattttaggtgcagttcaattcggtttttggtctatttaaacaatcctaaggtccgatttcgtt |
251 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6817192 |
tcttttaggtgcagttcaattcggtttttggtctatttaaacaatcctaaggtccgatttcgtt |
6817129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University