View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1757-Insertion-1 (Length: 444)
Name: NF1757-Insertion-1
Description: NF1757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1757-Insertion-1 |
 | |
|
| [»] scaffold0028 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0028 (Bit Score: 289; Significance: 1e-162; HSPs: 2)
Name: scaffold0028
Description:
Target: scaffold0028; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 8 - 300
Target Start/End: Original strand, 119186 - 119478
Alignment:
| Q |
8 |
ctattaactcttgaagcagttgagttttctttatggtaatgtggaagtttggattgtaatggagttgtggtgatagaggatgattcaacagtgtttgtaa |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
119186 |
ctattaactcttgaagcagttgagttttctttatggtaatgtggaagtttggattgtaatggagttgtggtgatagaggatgagtcaacagtgtttgtaa |
119285 |
T |
|
| Q |
108 |
catgatcatggttagtaaagaaaatttgtttagcatttgtaatctctgccagaggtgttgtgtagttaaaagtattgatggattttctttgagcattagt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
119286 |
catgatcatggttagtaaagaaaatttgtttagcatttgtaatctctgccagaggtgttgtgtagttaaaagtattgatggattttctttgagcattagt |
119385 |
T |
|
| Q |
208 |
catgccaaatggaggtgaaactctcttttcagatataactcttcttctattctgccttgaagaagttgagttctctttttcacgaagtgggtg |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
119386 |
catgccaaatggaggtgaaactctcttttcagatataactcttcttctattctgccttgaagaagttgagttctctttttcacgaagtgggtg |
119478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0028; HSP #2
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 293 - 386
Target Start/End: Original strand, 120898 - 120991
Alignment:
| Q |
293 |
agtgggtgattggattgtaatggtgttgtggaaatagatgaggcctcagcctaatttgtggatggtggctttaggttattatgttgaataatcc |
386 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
120898 |
agtgggtgattggattgtaatggtgttgtggaaatagatgaggcctcaacctgatttgtggatggtggcttaaggttattatgttgaataatcc |
120991 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 221 - 283
Target Start/End: Original strand, 23689824 - 23689886
Alignment:
| Q |
221 |
ggtgaaactctcttttcagatataactcttcttctattctgccttgaagaagttgagttctct |
283 |
Q |
| |
|
|||||| ||||||||||| | | ||||||||||||||| | ||| ||||||||||||||||| |
|
|
| T |
23689824 |
ggtgaagctctcttttcaaaaagaactcttcttctattatctcttaaagaagttgagttctct |
23689886 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University