View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1757-Insertion-19 (Length: 227)
Name: NF1757-Insertion-19
Description: NF1757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1757-Insertion-19 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 8 - 160
Target Start/End: Original strand, 38997120 - 38997270
Alignment:
| Q |
8 |
tatctttagtttttgcctctgtttatgcctttagttgtgaagttatgtttcggttcaatctggtttagtgatacaatcttttttgtagacgccaagatat |
107 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
38997120 |
tatctttagtttttgcctctgcttatgcctttagttgtgaagttatgtttcggttcaatttggtt--gtgatacaatcttttttgtagacgccaagatat |
38997217 |
T |
|
| Q |
108 |
acgactgagttacttagattcagtcatacggatcaaccggtgatccaacaatc |
160 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38997218 |
acgactgagttacttagattcagtcatacggatcaaccggtgatccaacaatc |
38997270 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University