View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1757-Insertion-33 (Length: 114)
Name: NF1757-Insertion-33
Description: NF1757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1757-Insertion-33 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 103; Significance: 1e-51; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 103; E-Value: 1e-51
Query Start/End: Original strand, 8 - 114
Target Start/End: Original strand, 41065620 - 41065726
Alignment:
| Q |
8 |
acttccactctctagttcaaattttcggttttgaatgatgttagagagatatttgtggatatgtttaagacttcggcttaagctcacttccattcctaag |
107 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41065620 |
acttccactctctagttcaaattttcggtgttgaatgatgttagagagatatttgtggatatgtttaagacttcggcttaagctcacttccattcctaag |
41065719 |
T |
 |
| Q |
108 |
cggaaca |
114 |
Q |
| |
|
||||||| |
|
|
| T |
41065720 |
cggaaca |
41065726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University