View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1757-Insertion-8 (Length: 131)
Name: NF1757-Insertion-8
Description: NF1757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1757-Insertion-8 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 112; Significance: 5e-57; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 112; E-Value: 5e-57
Query Start/End: Original strand, 8 - 131
Target Start/End: Original strand, 384723 - 384846
Alignment:
| Q |
8 |
tatatttctgaatatcacccagaagacgatcctgctcataattgttgttgtcgacaacgtcagtgggaagaagaagattaataggatgacgacaaagagg |
107 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
384723 |
tatatttctgaatatcacccagaagactatcctgctcataattgttgttgtcgacaacgtcagtgggaagaagaagattaataggacgacgacaaagagg |
384822 |
T |
|
| Q |
108 |
acatttgcaaggctgaagaggaga |
131 |
Q |
| |
|
|||||||||||| ||||||||||| |
|
|
| T |
384823 |
acatttgcaaggttgaagaggaga |
384846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 47; E-Value: 3e-18
Query Start/End: Original strand, 33 - 131
Target Start/End: Original strand, 390128 - 390226
Alignment:
| Q |
33 |
acgatcctgctcataattgttgttgtcgacaacgtcagtgggaagaagaagattaataggatgacgacaaagaggacatttgcaaggctgaagaggaga |
131 |
Q |
| |
|
|||||| |||||| ||||| || ||| || ||||| ||||||| |||||| ||||||||| ||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
390128 |
acgatcttgctcagaattggcgtcgtctacgacgtcggtgggaacaagaaggttaataggacgacgacagagaggacatttgcaaggttgaagaggaga |
390226 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University