View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17570_low_3 (Length: 224)
Name: NF17570_low_3
Description: NF17570
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17570_low_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 186; Significance: 1e-101; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 11 - 208
Target Start/End: Complemental strand, 31315227 - 31315030
Alignment:
| Q |
11 |
attatacttcaaagaaccataaacaagtgatgttctatctctacaaacctttgctgctctctccaagaagttgataggtgacaaaggaacagaatttgca |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31315227 |
attatacttcaaagaaccataaacaagtgatgttctgtctctacaaacctttgctgctctctccaagaagttgataggtgacaaaggaacagaatttgca |
31315128 |
T |
 |
| Q |
111 |
ttgcaatgaactagcccttccattgattcccatgatcctcgatcagggtccttagaaaagtttgagaatttacgtgagaaggtgtggtgagttgatct |
208 |
Q |
| |
|
| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31315127 |
tggcaatgaactagcccttgcattgattcccatgatcctcgatcagggtccttagaaaagtttgagaatttacgtgagaaggtgtggtgagttgatct |
31315030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 11 - 149
Target Start/End: Complemental strand, 31337275 - 31337137
Alignment:
| Q |
11 |
attatacttcaaagaaccataaacaagtgatgttctatctctacaaacctttgctgctctctccaagaagttgataggtgacaaaggaacagaatttgca |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31337275 |
attatacttcaaagaaccataaacaagtgatgttctgtctctacaaacctttgctgctctctccaagaagttgataggtgacaaaggaacagaatttgca |
31337176 |
T |
 |
| Q |
111 |
ttgcaatgaactagcccttccattgattcccatgatcct |
149 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31337175 |
ttgcaatgaactagcccttccattgattcccatgatcct |
31337137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University