View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17571_high_1 (Length: 609)
Name: NF17571_high_1
Description: NF17571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17571_high_1 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 118; Significance: 7e-60; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 118; E-Value: 7e-60
Query Start/End: Original strand, 132 - 257
Target Start/End: Complemental strand, 49217391 - 49217266
Alignment:
| Q |
132 |
gtggttagtttgtctatttatttctaacttttatatctctttttagagttctacgtcattaaataataggtgcgataataacaggtcaatatcgtaaacc |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49217391 |
gtggttagtttgtctatttatttctaacttttatatctcttattagagttctacgtcattaaataataggtgcgataataacaggtcaatatcgtaaacc |
49217292 |
T |
|
| Q |
232 |
attttccatagaataaaccaaacttc |
257 |
Q |
| |
|
|||||||||| ||||||||||||||| |
|
|
| T |
49217291 |
attttccatacaataaaccaaacttc |
49217266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 18 - 66
Target Start/End: Complemental strand, 49217437 - 49217389
Alignment:
| Q |
18 |
gaagcgtgaggggaacatgtatctttttctttgattattatctcatgtg |
66 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49217437 |
gaagcgtgaggggaacatgtatctttttctttgattattatctcatgtg |
49217389 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University