View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17572_low_1 (Length: 390)
Name: NF17572_low_1
Description: NF17572
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17572_low_1 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 337; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 337; E-Value: 0
Query Start/End: Original strand, 10 - 372
Target Start/End: Original strand, 9222804 - 9223163
Alignment:
| Q |
10 |
attattctggatatttgaaaaatttagccaatacacaattactttatgtgctaaaacacaaacttttataggtaaattattgttgccaccgtaatttatg |
109 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9222804 |
attattttggatatttgaaaaatttagccaatacaaaattactttatgtgctaaaacacaaacttttataggtaaattattgttgccaccgtaatttatg |
9222903 |
T |
|
| Q |
110 |
tcactaacgagaatgcaaaaatattgttgtagaaagctaaaaacaagacaattattgttgttgaatgagctgaaaataggagcagataccgtttttcctt |
209 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9222904 |
tcactaaccagaatgcaaaaatattgttgtagaaagctaaaaacaagacaattattgt---tgaatgagctgaaaataggagcagataccgtttttcctt |
9223000 |
T |
|
| Q |
210 |
ggaaagcttggaagaatgagaggaaattgcacacacatctacattcatctgcaagtatctcagacaattcttgtatgtttttatttttgaaggcagaata |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9223001 |
ggaaagcttggaagaatgagaggaaattgcacacacatctacattcatctgcaagtatctcagacaattcttgtatgtttttatttttgaaggcagaata |
9223100 |
T |
|
| Q |
310 |
aagtttcataactgcatctagggcttgatcattatcttctcccactggttctgagttcttctt |
372 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9223101 |
aagtttcataactgcatctagggcttgatcattatcttctcccactggttctgagttcttctt |
9223163 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University