View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17573_low_4 (Length: 221)
Name: NF17573_low_4
Description: NF17573
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17573_low_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 1 - 207
Target Start/End: Original strand, 2033504 - 2033695
Alignment:
| Q |
1 |
tcctagaaaagatattccaccggtttcggagacaaattcgccacactattgaactgtcattggaagaaagttcattgtcagtagcttcttcattatgtta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
2033504 |
tcctagaaaagatattccaccggtttcggagacaaattcgccacactattgaactgtcattggaagaaagttcaatgtcagtagcttcttcattat---- |
2033599 |
T |
 |
| Q |
101 |
aaagagaaacatatgatattggttaactcaatttaaccactgagagaataggttaatgaaagagcaatagnnnnnnnntaaatttctaaccttctgatgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2033600 |
----------atatgatattggttaactcaatttaaccactgagagaataggttaatgaaagagcaatag-aaaaaaataaatttctaaccttctgatgt |
2033688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University