View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17574_high_21 (Length: 415)
Name: NF17574_high_21
Description: NF17574
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17574_high_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 385; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 385; E-Value: 0
Query Start/End: Original strand, 13 - 409
Target Start/End: Complemental strand, 43615543 - 43615147
Alignment:
| Q |
13 |
aatatctgttggagtatatacttggtggggcctttacaaattgaagtccatgtctaacgtatttgtctcaaccctatagcatagcatggtataggtcatc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43615543 |
aatatctgttggagtatatacttggtggggcctttacaaattgaagtccatgtctaacgtatttgtctcaaccctatagcatagcatggtataggtcatc |
43615444 |
T |
 |
| Q |
113 |
ccattgaattgatgatgatgtaaaattcaacaatcatatctaataatttttggctgatatacatgtactctctaggctttctattccctttcaattttca |
212 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43615443 |
ccattgaattaatgatgatgtaaaattcaacaatcatatctaataatttttggctgatatacatgtactctctaggctttctattccctttcaattttca |
43615344 |
T |
 |
| Q |
213 |
ataccttgcccacaacgctccatgcagtccttcattactcctccttcattttcttacctgccccactgtgatttcactgttcttgaaatctaccctactc |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
43615343 |
ataccttgcccacaacgctccatgcagtccttcattactcctccttcattttcttacctgccccactgtgatttcactgttcttgcaatctaccctactc |
43615244 |
T |
 |
| Q |
313 |
aagattgctcaggattgcaccatgttgtttcagaattttgatctcagttagatcattcatgccctacatctacttatgggtcgattatattattctt |
409 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43615243 |
aagattgctcaggattgcaccatgttgtttcagaattttgatctcagttagatcatgcatgccctacatctacttatgggtcgattatattattctt |
43615147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University