View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17574_high_28 (Length: 362)
Name: NF17574_high_28
Description: NF17574
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17574_high_28 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 339; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 339; E-Value: 0
Query Start/End: Original strand, 1 - 347
Target Start/End: Original strand, 51687014 - 51687360
Alignment:
| Q |
1 |
taaccaaacatattttcattgcatttgtattactacaaaccaaacatggcaaaaggtggaaagctaatgaagctaaaatcagcactcaaaaaatggaact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51687014 |
taaccaaacatattttcattgcatttgtattactacaaaccaaacatggcaaaaggtggaaagctaatgaagctaaaatcagcactcaaaaaatggaact |
51687113 |
T |
|
| Q |
101 |
catttggaaacggaaaacagagccgtcacagcatcagcgccgtcgccgacgaagactcatcgtcttcaagatccgacctccacaccgtcttcgtaggaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51687114 |
catttggaaacggaaaacagagccgtcacagcatcagcgccgtcgccgacgaagactcatcgtcttcaagatccgacctccacaccgtcttcgtaggaaa |
51687213 |
T |
|
| Q |
201 |
atctcgccgcctctaccgtgtcacctccgacgttgttgacaaccctgtcttccgtgaactcgttgaaaggtcccgtgaaaccgaacaacaaaacgacact |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
51687214 |
gtctcgccgcctctaccgtgtcacctccgacgttgttgacaaccctgtcttccgtgaactcgttgaaaggtcccgtgaaacagaacaacaaaacgacact |
51687313 |
T |
|
| Q |
301 |
gtcaatgttgttgcttgtgaggttgtccttttcgaacatttgttatg |
347 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51687314 |
gtcaatgttgttgcttgtgaggttgtccttttcgaacatttgttatg |
51687360 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University