View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17574_high_47 (Length: 291)
Name: NF17574_high_47
Description: NF17574
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17574_high_47 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 162; Significance: 2e-86; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 102 - 283
Target Start/End: Complemental strand, 16455838 - 16455657
Alignment:
| Q |
102 |
acagtgttacagtgctgccatagccagtatttgccaacattttgtacataatagtctatcgtagatcaatagtgatttattaaaatcccacttagctata |
201 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
16455838 |
acagtgttacagtgctaccatagccagtatttgccaacattttgtacataatagtgtatcgtagatcaatagtgatttattaaaatcccagttagctata |
16455739 |
T |
|
| Q |
202 |
gtaccgctatggccggcaactgaaacactgctacaagcattaaagattctatgcagcatgggcacttctcctgtttcatatc |
283 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16455738 |
gcgccgctatggccggcaactgaaacactgctacaagcattaaagattctatgcagcatgggcacttctcctgtttcatatc |
16455657 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 11 - 109
Target Start/End: Complemental strand, 16456316 - 16456218
Alignment:
| Q |
11 |
actaccaaaaaataaattaaatatgtcaacaagccagagttgtcagttacagattgcgaaatatagtgatatgtttaaattccacaacggtacagtgtt |
109 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
16456316 |
actaccaataaataaattaaatatgtcaacaagccagaattgtcagttacagattgcgaaatataatgatatgtttaaattccacaacggtacagtgtt |
16456218 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University