View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17574_high_58 (Length: 252)
Name: NF17574_high_58
Description: NF17574
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17574_high_58 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 235
Target Start/End: Original strand, 42686945 - 42687185
Alignment:
| Q |
1 |
tgtgcattagtcgaaagagttttgtttggagtttctcacgaacaatgtgacaaccgatttcaatatgctcaataggctcgtgaaaggttgaatttgcagc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42686945 |
tgtgcattagtcgaaagagttttgtttggagtttctcgcgaacattgtgacaaccgatttcaatatgctcaataggctcgtgaaaggttgaatttgcagc |
42687044 |
T |
 |
| Q |
101 |
aatatgacaggtgaatttgccgtcacagtacagaaaagctggagtaatggaagcaacctg------tctaagtaaataagtcagacactgtaacctagac |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
42687045 |
aatatgacaggtgaatttgccgtcacagtacagaaaagctggagtaatggaagcaacctgaagatctctaagtaaataagtcagacactgtaacctagac |
42687144 |
T |
 |
| Q |
195 |
tggcagcgagagcacgttattcagcttctgttgagcaatga |
235 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
42687145 |
tggcagcgagagcacgatattcagcttctgttgagcaatga |
42687185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University